DXMit210 Primer Detail MGI Mouse MGI:706234

DXMit210 Primer Detail

Name

DXMit210
Primer 1 Sequence

GGGATAAAGTCTGAACTGTAGAAAGG
Primer 2 Sequence

AATGATGATTACTGACTTGCTCTCC
ID

MGI:706234
Product Size

111
Other IDs

DXMit210 (BROAD)
Note

MIT assay: MTH2574
Additional information: MIT STS Marker Data Files

DXMit210

DNA Segment, Chr X Massachusetts Institute of Technology 210

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit210	a	114bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	b	118bp	SPRET/EiJ
	c	124bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	140bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit210	a	124bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
	DXMit210	b	114bp	C57BL/6W, C57BL/10W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23