D4Mit69 Primer Detail MGI Mouse MGI:706016

D4Mit69 Primer Detail

Name

D4Mit69
Primer 1 Sequence

TGAAGGACAATGTGTGTGCA
Primer 2 Sequence

CACACAGAGATTTGTCCTCTGC
ID

MGI:706016
Product Size

130
Other IDs

D4Mit69 (BROAD)
Note

MIT assay: MPC269
Additional information: MIT STS Marker Data Files

D4Mit69

DNA segment, Chr 4, Massachusetts Institute of Technology 69

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit69	a	106bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	108bp	SPRET/EiJ
	c	128bp	B6.Cg-Lep^ob/+, C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D4Mit69	a	128bp	C57BL/6W
	b	116bp	129/SvW, C57BL/10W
	c	106bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23