About   Help   FAQ
D2Mit92 Primer Detail
Primers
  • Name
    D2Mit92
  • Primer 1 Sequence
    TGTATGCACAGGTATTTCCCC
  • Primer 2 Sequence
    TGAGGAAAGGGGATAAAATTTG
  • ID
    MGI:705631
  • Product Size
    149
  • Other IDs
    D2Mit92 (BROAD)
  • Note
    MIT assay: MPC420
    Additional information: MIT STS Marker Data Files
Genes
D2Mit92 DNA segment, Chr 2, Massachusetts Institute of Technology 92
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit92 a 148bp 129X1/Sv
f 168bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit92 a 148bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
b 152bp DBA/2J
c 158bp SPRET/EiJ
d 162bp CAST/EiJ
e 196bp NOD/MrkTac
f 198bp AKR/J
g 200bp A/J
h 210bp C3H/HeJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D2Mit92 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit92 c 141bp CBA/CaOlaHsd
s 144bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/09/2024
MGI 6.23 		The Jackson Laboratory