D17Mit50 Primer Detail MGI Mouse MGI:705390

D17Mit50 Primer Detail

Name

D17Mit50
Primer 1 Sequence

AGTCAAACCCAGGTCCTCTG
Primer 2 Sequence

CAATTAAGCAGTAGTGGTGATGC
ID

MGI:705390
Product Size

124
Other IDs

D17Mit50 (BROAD)
Note

MIT assay: B619
Additional information: MIT STS Marker Data Files

D17Mit50

DNA segment, Chr 17, Massachusetts Institute of Technology 50

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit50	a	114bp	AKR/J, BALB/cJ, C3H/HeJ
	b	118bp	A/J
	c	122bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, SPRET/EiJ
	d	124bp	LP/J
	e	134bp	NON/ShiLt
	f	156bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D17Mit50	b	125bp	C57BL/6JOlaHsd
	c	113bp	129P3/J, AKR/OlaHsd, BALB/cJ, C3H/HeJ
	d	119bp	A/JOlaHsd, DBA/2J
	j	133bp	JF1
	l	135bp	C57BL/10, SJL/J
	p	139bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23