D4Mit203 Primer Detail MGI Mouse MGI:705337

D4Mit203 Primer Detail

Name

D4Mit203
Primer 1 Sequence

GAATTCTTCCTGGGCCTTTC
Primer 2 Sequence

CAAGAGCCCAGGTGTGGTAT
ID

MGI:705337
Product Size

105
Other IDs

D4Mit203 (BROAD)
Note

MIT assay: MT2589
Additional information: MIT STS Marker Data Files

D4Mit203

DNA segment, Chr 4, Massachusetts Institute of Technology 203

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit203	a	89bp	CAST/EiJ
	b	102bp	LP/J
	c	106bp	B6.Cg-Lep^ob/+
	d	112bp	NOD/MrkTac
	e	118bp	A/J, AKR/J, BALB/cJ, DBA/2J
	f	122bp	SPRET/EiJ
	g	124bp	C3H/HeJ, NON/ShiLt
	h	144bp	C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D4Mit203	b	103bp	C57BL/6JOlaHsd, JF1
	d	113bp	AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
	l	115bp	SJL/J
	p	101bp	129P3/J, C57BL/10, PWB
	w	111bp	A/JOlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit203	a	smaller	129P3/J
	D4Mit203	s	larger	SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23