D2Mit525 Primer Detail MGI Mouse MGI:704175

D2Mit525 Primer Detail

Name

D2Mit525
Primer 1 Sequence

CACCTGACATCGACCTCTGA
Primer 2 Sequence

AGACCTGTGTGTCCATACACATG
ID

MGI:704175
Product Size

119
Other IDs

D2Mit525 (BROAD)
Note

MIT assay: MTH2458
Additional information: MIT STS Marker Data Files

D2Mit525

DNA Segment, Chr 2, Massachusetts Institute of Technology 525

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit525	a	119bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	125bp	A/J, BALB/cJ, SPRET/EiJ
	c	127bp	AKR/J, C3H/HeJ, LP/J, NON/ShiLt
	d	131bp	CAST/EiJ, NOD/MrkTac
	e	177bp	DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit525	a	129bp	129P3/J, AKR/OlaHsd, C3H/HeJ, SJL/J
	b	121bp	C57BL/6JOlaHsd
	c	127bp	BALB/cJ, C57BL/10
	d	181bp	DBA/2J
	j	105bp	JF1
	p	177bp	PWB
	w	125bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23