D12Mit56 Primer Detail MGI Mouse MGI:703602

D12Mit56 Primer Detail

Name

D12Mit56
Primer 1 Sequence

GCTGTTTCACAGTCATTCATAACA
Primer 2 Sequence

AACCTGCACAGGGTTTCCTT
ID

MGI:703602
Product Size

147
Other IDs

D12Mit56 (BROAD)
Note

MIT assay: MPC1610
Additional information: MIT STS Marker Data Files

D12Mit56

DNA segment, Chr 12, Massachusetts Institute of Technology 56

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit56	a	138bp	AKR/J, C3H/HeJ, NON/ShiLt
	b	147bp	CAST/EiJ
	c	148bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	d	156bp	A/J, BALB/cJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit56	c	smaller	CBA/Kw
	D12Mit56	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23