D7Mit120 Primer Detail MGI Mouse MGI:703345

D7Mit120 Primer Detail

Name

D7Mit120
Primer 1 Sequence

ACAGTGGGGAAACTAAGAAAAGG
Primer 2 Sequence

CGCATGTAGGCAGCAGTGTA
ID

MGI:703345
Product Size

268
Other IDs

D7Mit120 (BROAD)
Note

MIT assay: MPC11
Additional information: MIT STS Marker Data Files

D7Mit120

DNA segment, Chr 7, Massachusetts Institute of Technology 120

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit120	a	276bp	129S/SvEv, 129T1/Sv-Dnd1^Ter, 129X1/Sv, C3HeB/FeJ, C57BL/6J
Not Specified	D7Mit120	b	290bp	129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129X1/SvJ

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit120	a	276bp	129X1/Sv
		b	284bp	129T1/Sv-Dnd1^Ter
		c	290bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit120	a	276bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	b	282bp	C3H/HeJ, CAST/EiJ, NOD/MrkTac
	c	288bp	A/J
	d	290bp	AKR/J
	e	296bp	BALB/cJ

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23