D19Mit23 Primer Detail MGI Mouse MGI:702963

D19Mit23 Primer Detail

Name

D19Mit23
Primer 1 Sequence

CCATTTCCTTTGAGGATAGTGT
Primer 2 Sequence

AAATCTTGGCATTTCTCTTACTGG
ID

MGI:702963
Product Size

193
Other IDs

D19Mit23 (BROAD)
Note

MIT assay: B440
Additional information: MIT STS Marker Data Files

D19Mit23

DNA segment, Chr 19, Massachusetts Institute of Technology 23

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit23	a	186bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	180bp	129X1/SvJ
		c	186, 196bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit23	a	186bp	A/J, AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
	b	196bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	c	204bp	CAST/EiJ, SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit23	l	larger	LG/J
	D19Mit23	s	smaller	SM/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23