D17Mit22 Primer Detail MGI Mouse MGI:702762

D17Mit22 Primer Detail

Name

D17Mit22
Primer 1 Sequence

GGTAAGCATTAGATAGAGAG
Primer 2 Sequence

TTATGATCTCCACACACGTG
ID

MGI:702762
Product Size

189
Other IDs

D17Mit22 (BROAD)
Note

MIT assay: D16
Additional information: MIT STS Marker Data Files

D17Mit22

DNA segment, Chr 17, Massachusetts Institute of Technology 22

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit22	b	0.157kb	B10.BR-H2^k, BALB.K-H2^k, C57BL/6
Not Specified	D17Mit22	c	0.183kb	B10.D2-H2^d, BALB/cAnNCr, BALB/cByJ, BALB/cJ

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit22	a	smallest	SWR/J
		b	larger	SJL/J
		c	larger than above	C57BL/6J, CBA/J
		d	larger than above	A.CA-H2^f/Sn, M. spretus
		e	larger than above	P/J, SM/J
		f	larger than above	RIIIS/J
		g	larger than above	CAST/EiJ
		h	larger than above	M. caroli
		i	larger than above	DBA/2J

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit22	c	183bp	BALB/cJ
Not Specified	D17Mit22	s	157bp	129X1/SvJ, C57BL/6J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit22	a	155bp	LP/J
	b	157bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	c	159bp	A/J, C3H/HeJ
	d	162bp	SPRET/EiJ
	e	176bp	CAST/EiJ
	f	183bp	BALB/cJ, DBA/2J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit22	l	larger	LG/J
	D17Mit22	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit22	a	183bp	BALB/cW, DBA/2W
	b	157bp	129/SvW, A.CA/W, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	c	153bp	BN/aW

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23