D10Mit135 Primer Detail MGI Mouse MGI:702415

D10Mit135 Primer Detail

Name

D10Mit135
Primer 1 Sequence

CATGATCAAATACAATTCCTTGTG
Primer 2 Sequence

GCCTCGGTACAGGGGAAC
ID

MGI:702415
Product Size

147
Other IDs

D10Mit135 (BROAD)
Note

MIT assay: MT1255
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 135

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit135	a	147bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	b	175bp	DBA/2J
	c	177bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit135	a	175bp	A.CA/W, AKR/W, BALB/cW, DBA/2W
	D10Mit135	b	145bp	129/SvW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23