D12Mit231 Primer Detail MGI Mouse MGI:701854

D12Mit231 Primer Detail

Name

D12Mit231
Primer 1 Sequence

GAGTGGATAATGAAAATGTGGTG
Primer 2 Sequence

CCTGACATTTTTATGATTTTATTTTTC
ID

MGI:701854
Product Size

150
Other IDs

D12Mit231 (BROAD)
Note

MIT assay: MT5196
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 231

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit231	a	124bp	SPRET/EiJ
	b	132bp	LP/J
	c	140bp	A/J, C3H/HeJ
	d	148bp	CAST/EiJ
	e	150bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	f	156bp	DBA/2J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit231	c	larger	CBA/Kw
	D12Mit231	e	smaller	KE

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit231	b	lower	C57BL/6J
	D12Mit231	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23