D10Mit11 Primer Detail MGI Mouse MGI:701597

D10Mit11 Primer Detail

Name

D10Mit11
Primer 1 Sequence

GAGAAGTCACTGGGAGCTGG
Primer 2 Sequence

TTGCCAGGTTGCTCTTCTTT
ID

MGI:701597
Product Size

195
Other IDs

D10Mit11 (BROAD)
Note

MIT assay: A88
Additional information: MIT STS Marker Data Files

D10Mit11

DNA segment, Chr 10, Massachusetts Institute of Technology 11

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit11	b	larger	C57BL/6J
	D10Mit11	f	smaller	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit11	a	largest	C57BL/6, JF1, MSM/Ms
Not Specified	D10Mit11	b	smaller	DBA/2

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit11	m	190bo	MOLF/EiJ
Not Specified	D10Mit11	s	187bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit11	a	170bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
	b	173bp	SPRET/EiJ
	c	199bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit11	l	smaller	LG/J
	D10Mit11	s	larger	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23