D15Mit133 Primer Detail MGI Mouse MGI:700960

D15Mit133 Primer Detail

Name

D15Mit133
Primer 1 Sequence

GTGTGTTTTGTTCTTTGTAGGTGC
Primer 2 Sequence

TTCCCATACATGTGTAAATGTGC
ID

MGI:700960
Product Size

96
Other IDs

D15Mit133 (BROAD)
Note

MIT assay: MT1771
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 133

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit133	a	93bp	A/J, AKR/J
	b	97bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	c	103bp	BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	117bp	CAST/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit133	c	larger	CBA/Kw
	D15Mit133	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23