D17Mit30 Primer Detail MGI Mouse MGI:700954

D17Mit30 Primer Detail

Name

D17Mit30
Primer 1 Sequence

CAGGAGCCTGTATACCCACTG
Primer 2 Sequence

CCTCTTTTGGCTTCTGTGGA
ID

MGI:700954
Product Size

149
Other IDs

D17Mit30 (BROAD)
Note

MIT assay: A700
Additional information: MIT STS Marker Data Files

D17Mit30

DNA segment, Chr 17, Massachusetts Institute of Technology 30

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit30	a	247bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	229bp	129X1/SvJ
		c	229, 247bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit30	a	144bp	NON/ShiLt
	b	150bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac
	c	156bp	A/J, AKR/J, C3H/HeJ
	d	160bp	DBA/2J, SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23