D17Mit32 Primer Detail MGI Mouse MGI:700952

D17Mit32 Primer Detail

Name

D17Mit32
Primer 1 Sequence

TTGGAGCTGAATACACGCAC
Primer 2 Sequence

GATCTGGTGCTTGTTTATTCCC
ID

MGI:700952
Product Size

150
Other IDs

D17Mit32 (BROAD)
Note

MIT assay: D607
Additional information: MIT STS Marker Data Files

D17Mit32

DNA segment, Chr 17, Massachusetts Institute of Technology 32

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit32	a	130bp	AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
	b	150bp	B6.Cg-Lep^ob/+, C57BL/6J, SPRET/EiJ
	c	152bp	LP/J
	d	156bp	CAST/EiJ
	e	158bp	A/J, BALB/cJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit32	a	158bp	BALB/cW, BN/aW, DBA/2W
	b	150bp	129/SvW, C57BL/6W, C57BL/10W
	c	130bp	A.CA/W, AKR/W, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23