TJ-T25 Primer Detail MGI Mouse MGI:672

TJ-T25 Primer Detail

Name

TJ-T25
Primer 1 Sequence

TGACATTTTGCGATTTTCATTTGT
Primer 2 Sequence

GACACATGGATCCTCACATGC
ID

MGI:672
Product Size

90bp
Synonyms

T54

D10Nds3

DNA segment, Chr 10, Nuffield Department of Surgery 3

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Endonuclease	Gene	Allele	Fragments	Strains
	D10Nds3	n	smaller	AKR/J, B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, DBA/2J, NOD, NON
	D10Nds3	s	larger	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Endonuclease	Gene	Allele	Fragments	Strains
	D10Nds3	e	94bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	D10Nds3	f	89bp	CAST/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Endonuclease	Gene	Allele	Fragments	Strains
	D10Nds3	a	larger	AKR/J, C57BL/J, SM/J
	D10Nds3	l	smaller	LG/J

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23