Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Rag1em10Lutzy
Name:	recombination activating 1; endonuclease-mediated mutation 10, Cathy Lutz
MGI ID:	MGI:6681855
Gene:	Rag1  Location: Chr2:101468627-101479846 bp, - strand  Genetic Position: Chr2, 53.88 cM
Alliance:	Rag1em10Lutzy page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: CRISPR/cas9 genome editing is used to target intronic DNA flanking exon 2 (guide RNAs - AAGTGTCCCCAAATATTGTC ; GCACCTAGCACATTGCCATG). DNA sequencing of the targeted region identified a 3,527-nt deletion (AGTATAAGTGTCCCCAAAT//3527 deletion//GGTCAGGGATCGATAGTTGACAAG) that results in loss of exon 2 from the genome. (J:101977)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rag1 Mutation:	120 strains or lines available

Original:	J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:	3 reference(s)