Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Abca7em1Aduci
Name:	ATP-binding cassette, sub-family A member 7; endonuclease-mediated mutation 1, Frank LaFerla
MGI ID:	MGI:6506295
Synonyms:	Abca7*V1613M
Gene:	Abca7  Location: Chr10:79832328-79851406 bp, + strand  Genetic Position: Chr10, 39.72 cM
Alliance:	Abca7em1Aduci page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Humanized sequence) Mutation:    Nucleotide substitutions   Mutation details: Guide RNA (CTTGGTGGCAGTGTGCATAG) is designed to create a guanine to adenine missense mutation resulting in a valine to methionine change (V1613M) in the gene. This mutation (SNP rs117187003) is homologous to the human V1599M SNP which has been associated with increased risk of sporadic Alzheimer's disease. Two silent DNA mutations were also introduced just upstream of the mutation. (J:101977)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abca7 Mutation:	89 strains or lines available

Original:	J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:	1 reference(s)