Notch3 RT-PCR Gene Expression Assay

Gene Expression Data
Assay Details

Assay

Reference:	J:79434 Loomes KM, et al., Characterization of Notch receptor expression in the developing mammalian heart and liver. Am J Med Genet. 2002 Oct 1;112(2):181-9
Assay type:	RT-PCR
MGI Accession ID:	MGI:6501996
Gene symbol:	Notch3
Gene name:	notch 3

Probe:	Notch3-pG, Notch3-pH
Probe preparation:	labelled with FAM
Assay notes:	This assay is a quantitative RT-PCR. All expression levels were relative to levels detected at E11.5, and normalized with respect to Gapdh expression. (FAM)CTCATCGCCAGCCATGCCGA(TAMRA) was used as the probe.

Results

Image: 1H

	Sample Information		Bands	Other Sample Information
Lane	Age	Structure	Size Not Specified (a)	Amount	Genetic Background	Mutant Allele(s)	Sex
E11	E11.5	TS19: liver	Weak	1 µg	CD-1		Not Specified
E12	E12.5	TS20: liver	Weak	1 µg	CD-1		Not Specified
E13	E13.5	TS21: liver	Weak	1 µg	CD-1		Not Specified
E15	E15.5	TS23: liver	Weak	1 µg	CD-1		Not Specified
E18	E18.5	TS26: liver	Weak	1 µg	CD-1		Not Specified
NB	P newborn	TS27: liver	Weak	1 µg	CD-1		Not Specified
12WK	P w 12	TS28: liver	Present (b)	1 µg	CD-1		Not Specified

Notes:
(a) Expression remained relatively stable throughout gestation, ranging from about 0.4 to 2 times the initial level and peaked at 12 weeks of age at a fivefold increase compared with E11.5.
(b) 5 times the initial level.

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23