Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Gaaem1Jhng
Name:	glucosidase, alpha, acid; endonuclease-mediated mutation 1, Jeffrey Huang
MGI ID:	MGI:6454667
Synonyms:	Gaac.1826dupA
Gene:	Gaa  Location: Chr11:119158789-119176284 bp, + strand  Genetic Position: Chr11, 83.35 cM, cytoband D-E
Alliance:	Gaaem1Jhng page

Strain of Origin:

C57BL/6NJ

Allele Type:    Endonuclease-mediated (Humanized sequence) Mutation:    Nucleotide substitutions   Mutation details: Guide RNAs (GTACGCTGGTCACTGGACAG and CTGTCCAGTGACCAGCGTAC) are designed to insert an extra adenine at position 1826 (c.1826dupA), resulting in a tyrosine change to a premature stop codon at amino acid 609 (Tyr609*). This mutation results in a truncated protein as seen in patients with Infantile Onset Pompe Disease (IOPD). Silent protospacer adjacent motif (PAM) site mutations (GaaA>, GaaA>) and a gRNA seed region mutation (GaaT>) were also introduced to prevent gRNA editing of the donor template. (J:294027)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gaa Mutation:	54 strains or lines available

Original:	J:294027 Huang JY, et al., CRISPR-Cas9 generated Pompe knock-in murine model exhibits early-onset hypertrophic cardiomyopathy and skeletal muscle weakness. Sci Rep. 2020 Jun 25;10(1):10321
All:	1 reference(s)