Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Dbpht2em1(IMPC)J
Name:	DNA binding protein with his-thr domain; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6388622
Gene:	Dbpht2  Location: Chr12:74344248-74347242 bp, + strand  Genetic Position: Chr12, 32.46 cM
Alliance:	Dbpht2em1(IMPC)J page
IMPC:	Dbpht2 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTAACCATGAGTGG and ATAGATATCAGCATCTAGGA, which resulted in a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001420864 (exon 1) and 382 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to generate a null allele. (J:188991) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dbpht2 Mutation:	7 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	1 reference(s)