Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Vps36em1(IMPC)J
Name:	vacuolar protein sorting 36; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6383171
Gene:	Vps36  Location: Chr8:22682825-22710859 bp, + strand  Genetic Position: Chr8, 11.14 cM, cytoband A3
Alliance:	Vps36em1(IMPC)J page
IMPC:	Vps36 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGAGCGCTGTTCCCTAGG and AAATACATACGGTAAGAGCA, which resulted in a 302 bp deletion beginning at Chromosome 8 position 22,202,206 bp and ending after 22,202,507 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000209862 (exon 3) and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 12 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Vps36 Mutation:	16 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)