Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	U2af2em1(IMPC)J
Name:	U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6379288
Gene:	U2af2  Location: Chr7:5065142-5082937 bp, + strand  Genetic Position: Chr7, 2.93 cM, cytoband A1
Alliance:	U2af2em1(IMPC)J page
IMPC:	U2af2 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTAGGTCAACTAAGTTACG and ACTCTAGCTGGACTAAGTAC, which resulted in a 486 bp deletion beginning at Chromosome 7 position 5,070,084 bp and ending after 5,070,569 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000198884 (exon 7) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 201 and early truncation 5 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any U2af2 Mutation:	29 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)