Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Ss18em1(IMPC)J
Name:	SS18, subunit of BAF chromatin remodeling complex; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6363562
Gene:	Ss18  Location: Chr18:14757255-14815971 bp, - strand  Genetic Position: Chr18, 8.14 cM, cytoband B1
Alliance:	Ss18em1(IMPC)J page
IMPC:	Ss18 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTTGGTCTTGGGTCTTG and TCTTTGCAGTGTCGTGTTCA, which resulted in a 244 bp deletion beginning at Chromosome 18 position 14,679,354 bp and ending after 14,679,597 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000282373 (exon 2) and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 18 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ss18 Mutation:	40 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)