Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Dzip1lem1(IMPC)J
Name:	DAZ interacting protein 1-like; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6357885
Gene:	Dzip1l  Location: Chr9:99511549-99551309 bp, + strand  Genetic Position: Chr9, 51.93 cM, cytoband F1
Alliance:	Dzip1lem1(IMPC)J page
IMPC:	Dzip1l gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTAGATCCCCCAGACAGCG and CTACAGATGAGGCTACAGGG, which resulted in a 390 bp deletion beginning at Chromosome 9 position 99,639,764 bp and ending after 99,640,153 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219920 (exon 3) and 305 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 167 and early truncation 41 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

5 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dzip1l Mutation:	30 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)