Nufip2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Nufip2em1(IMPC)J |
Name: |
nuclear FMR1 interacting protein 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6258455 |
Gene: |
Nufip2 Location: Chr11:77576566-77608792 bp, + strand Genetic Position: Chr11, 46.74 cM
|
Alliance: |
Nufip2em1(IMPC)J page
|
IMPC: |
Nufip2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTACAATACAGCTTAGTAT and GGATAGCCTTTTTTTGTATT, which resulted in a 2080 bp deletion beginning at Chromosome 11 position 77,691,456 bp and ending after 77,693,535 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000292192 (exon 2) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 delete 571 amino acids and stop 28 amino acids later. This transcript does not go out of frame but removes >80% of the coding sequence.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|