Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Nufip2em1(IMPC)J
Name:	nuclear FMR1 interacting protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6258455
Gene:	Nufip2  Location: Chr11:77576566-77608792 bp, + strand  Genetic Position: Chr11, 46.74 cM
Alliance:	Nufip2em1(IMPC)J page
IMPC:	Nufip2 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTACAATACAGCTTAGTAT and GGATAGCCTTTTTTTGTATT, which resulted in a 2080 bp deletion beginning at Chromosome 11 position 77,691,456 bp and ending after 77,693,535 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000292192 (exon 2) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 delete 571 amino acids and stop 28 amino acids later. This transcript does not go out of frame but removes >80% of the coding sequence. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nufip2 Mutation:	52 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)