Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Tspyl1em1(IMPC)J
Name:	testis-specific protein, Y-encoded-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6200424
Gene:	Tspyl1  Location: Chr10:34158186-34160881 bp, + strand  Genetic Position: Chr10, 18.85 cM
Alliance:	Tspyl1em1(IMPC)J page
IMPC:	Tspyl1 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTCCCCTCGTCCCGCTCC and GCTCCCTTATTGGGCGACGT, which resulted in a 1076 bp deletion beginning at Chromosome 10 position 34,282,295 bp and ending after 34,283,370 bp (GRCm38/mm10). This mutation deletes 1076 bp of ENSMUSE00000350290 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 57 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tspyl1 Mutation:	13 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)