Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Zc3h13em1(IMPC)J
Name:	zinc finger CCCH type containing 13; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6189585
Gene:	Zc3h13  Location: Chr14:75521813-75581866 bp, + strand  Genetic Position: Chr14, 39.8 cM, cytoband D2
Alliance:	Zc3h13em1(IMPC)J page
IMPC:	Zc3h13 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CCAATAATAATAACACCATA, GTCAGGTAGGGGCTCTTTAA, AGAGAGTAGTTCCTGGAATG and CACCTGGGGCTGTGTCAGGT, which resulted in a 563 bp deletion beginning at Chromosome 14 position 75,291,999 bp and ending after 75,292,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122846 (exon 3) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 7 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zc3h13 Mutation:	64 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)