Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Mon2em1(IMPC)J
Name:	MON2 homolog, regulator of endosome to Golgi trafficking; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6163850
Gene:	Mon2  Location: Chr10:122827965-122912410 bp, - strand  Genetic Position: Chr10, 72.15 cM
Alliance:	Mon2em1(IMPC)J page
IMPC:	Mon2 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAGATGCTCAAAAAACTGG, AGTGTTCAGGCATTCCACCG, GAACTGATTTTATTTCCCAG and GTGTTGTGTGTGCCACTACT, which resulted in a 388 bp deletion beginning at Chromosome 10 position 123,059,114 bp and ending after 123,059,501 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000419243 (exon 2) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 1 amino acid later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mon2 Mutation:	86 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)