Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Rnf40em1(IMPC)J
Name:	ring finger protein 40; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6158667
Gene:	Rnf40  Location: Chr7:127187870-127202777 bp, + strand  Genetic Position: Chr7, 69.61 cM
Alliance:	Rnf40em1(IMPC)J page
IMPC:	Rnf40 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACTCAGACACATCACAC, CTGAGAACATAAGCTCCCCA, GGACAAGGATTAGACTGAAA and TGTGGGGCTACCGAAATGCC, which resulted in a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000203766 and ENSMUSE00000203748 (exons 3 and 4) and 283 bp of flanking intronic sequence including the splice acceptor and donor. There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 44 and early truncation 85 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf40 Mutation:	46 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)