Cherpem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cherpem1(IMPC)J |
Name: |
calcium homeostasis endoplasmic reticulum protein; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6151421 |
Gene: |
Cherp Location: Chr8:73214333-73229070 bp, - strand Genetic Position: Chr8, 35.08 cM
|
Alliance: |
Cherpem1(IMPC)J page
|
IMPC: |
Cherp gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCTGTTGCCAAATTCTATA, CCATTCTTAATGAGTAGGGA, CATCAGGTCCTCTCTCTGGA and CAGTGAGATCAAGCACAACA, which resulted in a 525 bp deletion beginning at Chromosome 8 position 72,470,672 bp and ending after 72,471,196 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463654 (exon 3) and 340 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion (CT) at the deletion site. This deletion is predicted to cause a change of amino acid sequence after residue 66 and early truncation 29 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|