Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Mpripem1(IMPC)J
Name:	myosin phosphatase Rho interacting protein; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6143823
Gene:	Mprip  Location: Chr11:59552973-59671686 bp, + strand  Genetic Position: Chr11, 37.76 cM
Alliance:	Mpripem1(IMPC)J page
IMPC:	Mprip gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTGCTCAGTGAGGAATGCTA, GCCAAGCTGGACTTATGTAG, GTATCAGGCAGCCTGCGTGG and ACACGGGACGTTTCTCAAAG, which resulted in a 655 bp deletion beginning at Chromosome 11 position 59,727,305 bp and ending after 59,727,959 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001091723 (exon 4) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 33 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mprip Mutation:	56 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)