Srbd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Srbd1em1(IMPC)J |
Name: |
S1 RNA binding domain 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6101175 |
Gene: |
Srbd1 Location: Chr17:86292093-86452603 bp, - strand Genetic Position: Chr17, 56.51 cM, cytoband E4
|
Alliance: |
Srbd1em1(IMPC)J page
|
IMPC: |
Srbd1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCCTCTTTCACCTGTACA, TGACTATTTTAAGAGTAATG, ATAAACCTACTCATGTCATG and TCTGCTTTAGAATTAAAGGA, which resulted in a 294 bp deletion beginning at Chromosome 17 negative strand position 86,142,597 bp and ending after 86,142,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001033695 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence from the first amino acid and early truncation 4 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|