Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Srbd1em1(IMPC)J
Name:	S1 RNA binding domain 1; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6101175
Gene:	Srbd1  Location: Chr17:86292093-86452603 bp, - strand  Genetic Position: Chr17, 56.51 cM, cytoband E4
Alliance:	Srbd1em1(IMPC)J page
IMPC:	Srbd1 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCCTCTTTCACCTGTACA, TGACTATTTTAAGAGTAATG, ATAAACCTACTCATGTCATG and TCTGCTTTAGAATTAAAGGA, which resulted in a 294 bp deletion beginning at Chromosome 17 negative strand position 86,142,597 bp and ending after 86,142,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001033695 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence from the first amino acid and early truncation 4 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Srbd1 Mutation:	68 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)