Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Map7d1em1(IMPC)J
Name:	MAP7 domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5927681
Gene:	Map7d1  Location: Chr4:126125960-126150112 bp, - strand  Genetic Position: Chr4, 60.16 cM
Alliance:	Map7d1em1(IMPC)J page
IMPC:	Map7d1 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACACTATACACAAGGCGGT, TGGAAGTGCTGGCAGACGGG, GGAAGTGACTCAAGTCCATG and GATAGGGATCTATCACACAT, which resulted in a 325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 210 and early truncation 9 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Map7d1 Mutation:	46 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)