Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Riok1em1(IMPC)J
Name:	RIO kinase 1; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5911955
Gene:	Riok1  Location: Chr13:38220971-38245409 bp, + strand  Genetic Position: Chr13, 17.91 cM
Alliance:	Riok1em1(IMPC)J page
IMPC:	Riok1 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAAAGCCAACACCCACTGA, ATTCATACACCTACTTTCAG and GGGATCCACAACATCTAAGC, which resulted in a 626 bp deletion beginning at Chromosome 13 positive strand position 38,039,914 bp and ending after 38,040,539 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117768 (exon 2) and 424 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small 6 bp (TGAAAG) deletion 121 bp before the 626 bp del that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 23 and early truncation 30 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Riok1 Mutation:	28 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	3 reference(s)