Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Sap18em1(IMPC)J
Name:	Sin3-associated polypeptide 18; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5911231
Gene:	Sap18  Location: Chr14:58035646-58042437 bp, + strand  Genetic Position: Chr14, 30.51 cM
Alliance:	Sap18em1(IMPC)J page
IMPC:	Sap18 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TGCGGGTTGCGGGCGGCTGC, TTTAATATCTTGGTGCTGCGand GCGGTAGGATAAGATGGTAG, which resulted in a 432 bp deletion beginning at Chromosome 14 positive strand position 57,798,370 bp and ending after 57,798,801 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122492 (exon 2) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 9 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sap18 Mutation:	15 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)