Tm2d3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tm2d3em1(IMPC)J |
Name: |
TM2 domain containing 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5907977 |
Gene: |
Tm2d3 Location: Chr7:65343204-65351650 bp, + strand Genetic Position: Chr7, 35.26 cM, cytoband C
|
Alliance: |
Tm2d3em1(IMPC)J page
|
IMPC: |
Tm2d3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTCGTATGTAGCATCGA, TAGGGCCTAGCAGTTCATAT, GATGGCCCTGGACCCACCTG and CGCAGGTCTACAAGACAAGG, which resulted in a 516 bp deletion beginning at Chromosome 7 positive strand position 65,697,589 bp, CTATATGAACTGCTAGGCCC, and ending after CAGACTAGCTTCCAGCGACA at 65,698,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200011 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic insertion TT 20 bp before the deletion and a 22 bp intronic deletion (CACCTGGGGCATCGCTTGCTTT) that is replaced with a 23 bp insertion (ATCGCTGGAAGCTAGTCTGAGAA 7:65,698,083-65,698,102) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 92 and early truncation 59 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|