Zfp407em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp407em1(IMPC)J |
Name: |
zinc finger protein 407; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5907859 |
Gene: |
Zfp407 Location: Chr18:84225826-84612815 bp, - strand Genetic Position: Chr18, 57.53 cM
|
Alliance: |
Zfp407em1(IMPC)J page
|
IMPC: |
Zfp407 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCTGGCTCTCACAGCAA, TTACCATAACAAAGGGAAGG, GCAGTTCTCACCTAGACTGA, and TGTATGGGTGAGATAATTAT, which resulted in a 423 bp deletion beginning at Chromosome 18 negative strand position 84,553,166 bp, GTGAGATAATTATGGGAATA, and ending after TGCGTATCCTCCTTCCCTTT at 84,552,744 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220921 (exon 3) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1554 and early truncation 3 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|