Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Plod2em1(IMPC)J
Name:	procollagen lysine, 2-oxoglutarate 5-dioxygenase 2; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5903134
Gene:	Plod2  Location: Chr9:92424276-92490481 bp, + strand  Genetic Position: Chr9, 48.4 cM
Alliance:	Plod2em1(IMPC)J page
IMPC:	Plod2 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from project Plod2-8544J-3803F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTTGTGTAACTAATCAG, GCTGTTTCTCCATAACATTA, GTTGAAAACATGATGGGACG and ATGACCCTCCAAAGGAAGTC, which resulted in a 390 bp deletion beginning at Chromosome 9 positive strand position 92,571,193 bp, CATAATGTTATGGAGAAACA, and ending after AAAACATGATGGGACGGGGC at 92,571,582 bp (GRCm38/mm10). This mutation deletes exon 2 and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 11 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Plod2 Mutation:	45 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)