Plod2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Plod2em1(IMPC)J |
Name: |
procollagen lysine, 2-oxoglutarate 5-dioxygenase 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5903134 |
Gene: |
Plod2 Location: Chr9:92424276-92490481 bp, + strand Genetic Position: Chr9, 48.4 cM
|
Alliance: |
Plod2em1(IMPC)J page
|
IMPC: |
Plod2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Plod2-8544J-3803F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTTGTGTAACTAATCAG, GCTGTTTCTCCATAACATTA, GTTGAAAACATGATGGGACG and ATGACCCTCCAAAGGAAGTC, which resulted in a 390 bp deletion beginning at Chromosome 9 positive strand position 92,571,193 bp, CATAATGTTATGGAGAAACA, and ending after AAAACATGATGGGACGGGGC at 92,571,582 bp (GRCm38/mm10). This mutation deletes exon 2 and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 11 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|