Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Fdx2em1Murr
Name:	ferredoxin 2; endonuclease-mediated mutation 1, Stephen Murray
MGI ID:	MGI:5819262
Synonyms:	Fdx1lem1Murr
Gene:	Fdx2  Location: Chr9:20978808-20984827 bp, - strand  Genetic Position: Chr9, 7.7 cM, cytoband A3
Alliance:	Fdx2em1Murr page

Strain of Origin:

C57BL/6NJ

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a 13 bp deletion (ATCATGGCCGCCT) beginning at Chromosome 9 negative strand position 21,073,509 bp, and ending after 21,073,497 bp (GRCm38/mm10). This mutation deletes the start of exon 1 and 3 bp of flanking intronic sequence including the splice acceptor and is predicted to be a null allele. (J:188991) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fdx2 Mutation:	12 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	1 reference(s)