Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Engaseem2Lutzy
Name:	endo-beta-N-acetylglucosaminidase; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID:	MGI:5700326
Synonyms:	Engaseem2(4del)Lutzy
Gene:	Engase  Location: Chr11:118367655-118380035 bp, + strand  Genetic Position: Chr11, 83.21 cM
Alliance:	Engaseem2Lutzy page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Not Applicable) Mutation:    Intragenic deletion   Mutation details: The allele was generated by injecting Cas9 RNA and guide sequences homologous to Engase exon 3 (GTGGAGGCCGGCGACACACC and GGAGGCCGGCGACACACCAG). The CRISPR/cas9 endonuclease mediated genome editing introduced a 4 nt (gtgt) deletion within exon 3. The mutant generated contains a discrete 4 nt GTGT deletion in exon 3 within the Engase open reading frame causing a frameshift beginning at Val 104 and leading to translation termination 18 amino acids later. The mutant mouse is predicted to express a 121 amino acid 13.5 kDa polypeptide from the Engase gene. (J:101977)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Engase Mutation:	25 strains or lines available

Original:	J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:	1 reference(s)