Il5ra-pA, Il5ra-pB Primer Detail MGI Mouse MGI:412

About Help FAQ

Il5ra-pA, Il5ra-pB Primer Detail

Name

Il5ra-pA, Il5ra-pB
Primer 1 Sequence

CCGTGATAAGAGCAAGGACT
Primer 2 Sequence

GGTGACTCATGTCTGGATGG
ID

MGI:412

Il5ra

interleukin 5 receptor, alpha

J:13564 Jacob CO, et al., Mamm Genome. 1993;4(8):435-9

Gene	Allele	Fragments	Strains
Il5ra	b	280.0bp	BXSB, C57BL/6, NOD, NON, SJL/J
	c	282.0bp	AKR/J, BALB/c, C3H/HeJ, CBA/J, DBA/1, DBA/2, MRL, NZB, NZW, P/J, PL/J, SM/J, SWR
	s	262.0bp	M. spretus

J:13564 Jacob CO, et al., Mapping of the interleukin 5 receptor gene to human chromosome 3 p25-p26 and to mouse chromosome 6 close to the Raf-1 locus with polymorphic tandem repeat sequences. Mamm Genome. 1993;4(8):435-9

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23