OR10, OR11 Primer Detail MGI Mouse MGI:1934216

About Help FAQ

OR10, OR11 Primer Detail

Name

OR10, OR11
Primer 1 Sequence

AATGGCCCCGGTCAACTTCC
Primer 2 Sequence

GCTGGGCCTCCTCCTCTATTCTC
ID

MGI:1934216
Product Size

0.19 kb

Nfkb2	nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Psd	pleckstrin and Sec7 domain containing

J:68175 Rieger DK, et al., Genomics. 2001 Feb 15;72(1):61-72

Gene	Allele	Fragments	Strains
Nfkb2	a	not given	129, (C57BL/6 x C57BLKS-Pitx3^ak)F1, C57BL/6
	c	not given	CAST/EiJ
	d	not given	DBA/2
	s	not given	SPRET/EiJ
Psd	a	not given	129, (C57BL/6 x C57BLKS-Pitx3^ak)F1, C57BL/6
	c	not given	CAST/EiJ
	d	not given	DBA/2
	s	not given	SPRET/EiJ

J:68175 Rieger DK, et al., A double-deletion mutation in the pitx3 gene causes arrested lens development in aphakia mice. Genomics. 2001 Feb 15;72(1):61-72

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23