Summary | Mutation origin | Mutation description | Expression | Phenotypes | Disease models | Find Mice (IMSR) | References

Symbol:	Atp8a2wl
Name:	ATPase, aminophospholipid transporter-like, class I, type 8A, member 2; wabbler lethal
MGI ID:	MGI:1856271
Synonyms:	Wl
Gene:	Atp8a2  Location: Chr14:59884980-60324363 bp, - strand  Genetic Position: Chr14, 31.49 cM
Alliance:	Atp8a2wl page

Strain of Origin:

STOCK Grxcr1pi

Allele Type:    Spontaneous Mutation:    Intragenic deletion   Mutation details: Spontaneous deletion of 21 bp (agccatcgaagaccgtcttca) in exon 22 results in elimination of seven highly conserved amino acids (AIEDRLQ) from the nucleotide-binding domain (N-domain). (J:188127, J:222308) Inheritance:    Recessive

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

4 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Atp8a2 Mutation:	74 strains or lines available

Original:	J:13068 Dickie MM, et al., A juvenile wabbler-lethal in the house mouse. J Hered. 1952;43(6):283-286
All:	12 reference(s)