About   Help   FAQ
Myf6-pC, Myf6-pD Primer Detail
Primers
  • Name
    Myf6-pC, Myf6-pD
  • Primer 1 Sequence
    GAGAGGAACACGTTCTGGCTCC
  • Primer 2 Sequence
    TGCTGGAGGCTGAGGCATCC
  • ID
    MGI:1334541
  • Product Size
    0.45kb
  • Synonyms
    Herculin primer
Genes
Myf6 myogenic factor 6
Expression
  • Assay Results
    41
References
J:767 Hannon K, et al., Temporal and quantitative analysis of myogenic regulatory and growth factor gene expression in the developing mouse embryo. Dev Biol. 1992 May;151(1):137-44
J:29672 Rawls A, et al., Myogenin's functions do not overlap with those of MyoD or Myf-5 during mouse embryogenesis. Dev Biol. 1995 Nov;172(1):37-50
J:49013 Yamane A, et al., Induced expression of myoD, myogenin and desmin during myoblast differentiation in embryonic mouse tongue development. Arch Oral Biol. 1998 May;43(5):407-16
J:63331 Yamane A, et al., Expression of myogenic regulatory factors during the development of mouse tongue striated muscle. Arch Oral Biol. 2000 Jan;45(1):71-8
J:74099 Yamane A, et al., Delayed embryonic development of mouse masseter muscle correlates with delayed MyoD family expression. J Dent Res. 2000 Dec;79(12):1933-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/09/2024
MGI 6.23
The Jackson Laboratory